Home | Guide | Download | Contact Us
1. Inputs
1.1 A file of complete genomic sequences in FASTA format
This format contains:
  • *A ">" symbol at the beginning of the title line and followed a description
  • *The sequence itself at a new line
An example:

>gi|163854304|ref|NC_010170.1| Bordetella petrii DSM 12804, complete genome
ATGAAAGAATTCTGGCAGACCTGCGTCAGTCGTCTAGAGCAGGAACTCCCCCCCCAACAGATCAGCGCCT
GGATACGGCCGCTGGTGCCGCTTGCGTACGACGAGACGCAGGCCGTGTTACGCGTTGCCGCTCCCAATCG
GTTCAAGCTCGACTGGGTGCGCAAGAACTTTTCCCACCAGATAGAGGCCCTGGCGGCGGAATGGTTCCAG
CGCCCCGTGCAGGTGGCGTTCGAGCTGCCGGCCGGCGGCGCCGGGCCGCGCATGCCGGCGGTGCCGCGGA
... ...
1.2 A file of annotation
This file is optional, Zisland Explorer will identify genes using Zcurve3.0 to identify genes when annotation file is unavailable.
The annotation file contains:
  • *Descriptions at the first 3 lines
  • *Annotations at the forth line, "Location" and "Strand" are essential for identifying genes
An example:

Bordetella petrii DSM 12804, complete genome - 1..5287950
5027 proteins
Location  Strand  Length  PID  Gene Synonym  Code  COG  Product
1..1437  +  478  163854305  dnaA Bpet0001  -  COG0593L  chromosomal replication initiation protein
... ...
2. Outputs
2.1 Predicted genomic islands

An example:
NO.  Position  Length  Gene  Score
GI1  217249..256564  39316  38  0.482
GI2  1029715..1035208  5494  7  0.448
GI3  1077590..1133303  55714  66  0.292
... ...
2.2 cumulative-GC-profile

An example:
Red points denote predicted genomic islands.

Links: [ CEFG | ZCURVE | GC-Profile | Contact Us ]